BLOG: The Weekly Challenge #061

https://perlweeklychallenge.org/blog/weekly-challenge-061

Perl Weekly Challenge 058: Compare Version and Ordered Lineup

Compare Version

Compare two given version number strings v1 and v2 such that:
  • If v1 > v2 return 1
  • If v1 < v2 return -1
  • Otherwise, return 0

The version numbers are non-empty strings containing only digits, and the dot (“.”) and underscore (“_”) characters. (“_” denotes an alpha/development version, and has a lower precedence than a dot, “.”). Here are some examples:

v1v2Result
0.1<1.1-1
2.0>1.21
1.2<1.2_5-1
1.2.1>1.2_11
1.2.1=1.2.10

When I read the task assignment, I thought to myself: I’m not the first person in the world that needs to compare versions. There already must be a module on CPAN that does exactly that. As usually, it wasn’t so simple.

Perl Weekly Challenge 93: Max Points and Sum Path

These are some answers to the Week 93 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a day or so. This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Max Points

You are given set of co-ordinates @N.

Write a script to count maximum points on a straight line when given co-ordinates plotted on 2-d plane.

Example 1:

New release of RT::Client::REST

A very welcome PR for adding the new SLA parameters for RT 4.4.3 was provided to RT::Client::REST on githib, which went out in v0.57 just earlier this week.

However this spurred me to take care of another PR that was been floating which allowed more verbose error messaging to be enabled. I also returned to my proposed fix for RT118729 which is because of mishandling of RT's strange "REST" (it's not really) interface.

If you are using RT::Client::REST i urge you to update it. Testing it carefully first before deploying. Bug reports are welcome especially when a fix is provided!

See https://metacpan.org/release/RT-Client-REST

BLOG: The Weekly Challenge #058

https://perlweeklychallenge.org/blog/weekly-challenge-058

CY's take on Perl Weekly Challenge #057

This is a part of Perl Weekly Challenge(PWC) #057 and the followings are related to my solution.

Do tell me if I am wrong or you strongly oppose my statements!

Task 1: Invert Tree

There is a module Tree::Binary on CPAN and its method "mirror" does what exactly describe in the Task 1. Of course, the experience of using a shortcut won't be filled a blog post.

Last week (PWC #056) I did not attempt the binary tree task but I did read the blogs of other PWC members.

Hence, it's time for my "blog report". Blog posts I use as reference are

Discovered from reading, one of the ways of representing a binary tree which I hadn't thought of but very intuitive, is putting the nodes row by row!

Just like this:

Perl Weekly Challenge 92: Isomorphic Strings and Insert Intervals

These are some answers to the Week 92 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few hours. This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Isomorphic Strings

You are given two strings $A and $B.

Write a script to check if the given strings are Isomorphic. Print 1 if they are, otherwise 0.

Example 1:

Input: $A = "abc"; $B = "xyz"
Output: 1

Example 2:

Input: $A = "abb"; $B = "xyy"
Output: 1

Example 3:

Input: $A = "sum"; $B = "add"
Output: 0

Isomorphic Strings in Raku

Perl Weekly Challenge 057: Invert Tree and Shortest Unique Prefix

Shortest Unique Prefix

Write a script to find the shortest unique prefix for each each word in the given list. The prefixes will not necessarily be of the same length.

Sample Input

[ "alphabet", "book", "carpet", "cadmium", "cadeau", "alpine" ]

Expected Output

[ "alph", "b", "car", "cadm", "cade", "alpi" ]

Let me start with the second task as it was definitely simpler (at least for me).

We iterate over all the input words. For each word, we try to find the shortest prefix possible. To know what prefixes have already been used, we keep two hashes: one stores the abandoned prefixes (i.e. those that were not unique anymore), the second one stores the “current” prefixes (the prefix is the key, the actual word is the value). We start from length 1 and add 1 in each step. If the prefix isn’t used and hasn’t been used, we assign it to the word and proceed to the next word. If the prefix is currently used for a different word, we store the prefix as “used” and prolong the prefix for the old word by one—but we continue the loop for the current word, in case their common prefix is longer.

PWC 057: Task #1, Invert Tree & Task #2, Shortest Unique Prefix

PWC Task #1, Invert Tree

jaredor submission for Task #1

The problem is in two parts, flipping the tree and pretty-printing it.

The flipping part is pretty easy, but since I'm a huge fan of Higher Order Perl I thought I should at least try to make it sort of like the tree walking code I remembered reading, where you give the tree-walker the function you want to operate on each node. (That word, "remembered" should be a hint that I haven't read the book in years and you should really go read the master.) I wrote both a depth-first and a breadth-first binary tree walker. For the purposes of flipping the whole tree, either one would have sufficed, but it is handy to have the option when you are experimenting.

BLOG: The Weekly Challenge #056

https://perlweeklychallenge.org/blog/weekly-challenge-056

Perl Weekly Challenge 91: Count Numbers and Jump Games

These are some answers to the Week 91 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few days (December 20, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Count Numbers

You are given a positive number $N.

Write a script to count number and display as you read it.

Example 1:

Input: $N = 1122234
Output: 21321314

as we read "two 1 three 2 one 3 one 4"

Example 2:

the Giant Planet of Perl

Finally I saw posts of PWC#056 on blogs.perl.org .

I haven't found what to discuss about #056 Task #1. Just to keep people know this code producer is alive and healthy, I share my recent life:

On Perl resources:

1. Perl Monks

From a blogpost[1], I was hooked to https://www.perlmonks.com/ . Apart from many advanced Perl discussions, there is a book review section (not very active):

Book Reviews of Perl Monks

Yesterday I got the "Perl Debugged" and "Perl Best Practices" on my hand, which are both recommended for fresh-to-intermediate Perl programmers. Yeah!

( The Best Practices seems to be accepted as one of commons among Perl programmers. There is Perl::Critic (learnt from the PWC Champion Interview March 2020). And there is a reference sheet on the book. )

The monks also have a tutorial section:

Tutorials of Perl Monks

2. Perl Weekly

I discovered the perlweekly.com by... Searching my own name on the Internet. (Sorry, I have some kinds of narcissistic behaviour).

PWC 056: Task #1, Diff-K & Task #2, Path Sum

After posting two separate blogs for PWC 055 and seeing how awkward the explanations were, I'll try a new tack: Both submissions will be elaborated in one blog post. The elaborations will not be explanations. I'll focus more on the "idea" part and let any programming details come out in the comments, if at all.

PWC Task #1, Diff-K

jaredor submission for Task #1

Input

For input I decided that all the numbers in the array would be command line arguments. That meant that 'k' would have to be a command line option. There was some validation that the stated requirements were met.

One input requirement "given an array @N of positive integers (sorted)" seemed to say that the input array should be sorted. The algorithm I chose worked without any sorting requirement on input, so this was not checked.

Case 1: k > 0

Perlmongers Conferences in the Time of Corona

I’m collecting different setups here. Other efforts are underway to organize a virtual conference. The setups listed below aim for smaller audiences with hopefully lower effort in setting things up.

I don’t discuss the other stuff needed for organizing a conference, like the social aspects (“hallway track”, “moderation”, “timekeeping”) or how people can forward questions from the chat to the speaker. The logistic aspects are mostly that outside of the “producer”, ideally nobody needs to install software beyond Chromium or another browser compatible enough with Jitsi to do video streaming.

Perl Weekly Challenge 90: DNA Sequence and Ethiopian Multiplication

These are some answers to the Week 90 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few days (December 13, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: DNA Sequence

DNA is a long, chainlike molecule which has two strands twisted into a double helix. The two strands are made up of simpler molecules called nucleotides. Each nucleotide is composed of one of the four nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).

You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.

Write a script to print nucleobase count in the given DNA sequence. Also print the complementary sequence where Thymine (T) on one strand is always facing an adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and vice versa.

To get the complementary sequence use the following mapping:

CY's take Perl Weekly Challenge on #055

This is a part of Perl Weekly Challenge(PWC) #055 and the followings are related to my solution.

Do tell me if I am wrong or you strongly oppose my statements!

named.jpg

Oh.

BLOG: The Weekly Challenge #055

https://perlweeklychallenge.org/blog/weekly-challenge-055

Docker::Names::Random

If you are using Docker, you may have noticed that it creates random names for containers when you haven't provided any specific name. These names are a combination of an adjective and a proper name of an individual. The individuals are famous men and women picked from the history of scientific exploration and engineering.

This package allows you to use the same system in your own programs. You would get combinations like interesting_mendeleev, epic_engelbart, lucid_dhawan, recursing_cori, ecstatic_liskov and busy_ardinghelli.

The combination boring_wozniak is not allowed because Steve Wozniak is not boring. This same limitation exists in the original code.

SYNOPSIS

Perl Weekly Challenge 89: GCD Sums and Magic Squares

These are some answers to the Week 89 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Task 1: GCD Sums

You are given a positive integer $N.

Write a script to sum GCD of all possible unique pairs between 1 and $N.

Example 1:

Input: 3
Output: 3

gcd(1,2) + gcd(1,3) + gcd(2,3)

Example 2:

Input: 4
Output: 7

gcd(1,2) + gcd(1,3) + gcd(1,4) + gcd(2,3) + gcd(2,4) + gcd(3,4)

GCD Sums in Raku

KBOS attributes

Welcome to the fifth post about the Kephra Base Object System, where I explain the need for three kinds of attributes: data, delegating and wrapping and gas a little about their properties. It is especially advised to have read the first part (scopes) and the previous part, since accessors are methods.

In case you wonder how practical this exercise is - I already implemented a slightly simpler version and currently rewrite it. It's a standalone bundle of modules with its own tests and docs named Base-Class (Kephra::Base::Class) (123kB), which depends only on the bundle Base (there are the data types) (32 kB). So once ready it could be released on CPAN without much work.

About blogs.perl.org

blogs.perl.org is a common blogging platform for the Perl community. Written in Perl with a graphic design donated by Six Apart, Ltd.