Diff-K
You are given an array @N of positive integers (sorted) and another non negative integer $k. Write a script to find if there exists 2 indices $i and $j such that $A[$i] - $A[$j] == $k and $i != $j. It should print the pairs of indices, if any such pairs exist.
Example:
@N = (2, 7, 9);
$k = 2;
Output: 2, 1
I totally ignored the fact that the input array is sorted. My solution works for any input array, but it’s still rather efficient.
The basic trick is that we don’t have to compute $A[$i] - $A[$j] for each combination or $i and $j. We know $k from the very beginning, so we can just iterate the array for the first time to store it in a hash, and iterate it for the second time to check the hash whether the corresponding number exists in the array.
These are some answers to the Week 92 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a few hours. This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
Task 1: Isomorphic Strings
You are given two strings $A and $B.
Write a script to check if the given strings are Isomorphic. Print 1 if they are, otherwise 0.
Example 1:
Input: $A = "abc"; $B = "xyz"
Output: 1
Example 2:
Input: $A = "abb"; $B = "xyy"
Output: 1
Example 3:
Input: $A = "sum"; $B = "add"
Output: 0
Isomorphic Strings in Raku
After posting two separate blogs for PWC 055 and seeing how awkward the explanations were, I'll try a new tack: Both submissions will be elaborated in one blog post. The elaborations will not be explanations. I'll focus more on the "idea" part and let any programming details come out in the comments, if at all.
Input
For input I decided that all the numbers in the array would be command line arguments. That meant that 'k' would have to be a command line option. There was some validation that the stated requirements were met.
One input requirement "given an array @N of positive integers (sorted)" seemed to say that the input array should be sorted. The algorithm I chose worked without any sorting requirement on input, so this was not checked.
Case 1: k > 0
I’m collecting different setups here. Other efforts are underway to organize
a virtual conference. The setups listed below aim for smaller audiences with
hopefully lower effort in setting things up.
I don’t discuss the other stuff needed for organizing a conference, like
the social aspects (“hallway track”, “moderation”, “timekeeping”) or how
people can forward questions from the chat to the speaker. The logistic
aspects are mostly that outside of the “producer”, ideally nobody needs to
install software beyond Chromium or another browser compatible enough with
Jitsi to do video streaming.
These are some answers to the Week 91 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a few days (December 20, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
Task 1: Count Numbers
You are given a positive number $N.
Write a script to count number and display as you read it.
Example 1:
Input: $N = 1122234
Output: 21321314
as we read "two 1 three 2 one 3 one 4"
Example 2:
This is a part of Perl Weekly Challenge(PWC) #055 and the followings are related to my solution.
Do tell me if I am wrong or you strongly oppose my statements!
Oh.
If you are using Docker, you may have noticed that it
creates random names for containers when you haven't provided any
specific name. These names are a combination of an adjective
and a proper name of an individual. The individuals are
famous men and women picked from the history of scientific exploration
and engineering.
This package allows you to use the same system in your own programs.
You would get combinations like
interesting_mendeleev,
epic_engelbart,
lucid_dhawan,
recursing_cori,
ecstatic_liskov and
busy_ardinghelli.
The combination boring_wozniak is not allowed because
Steve Wozniak is not boring.
This same limitation exists in the
original code.
SYNOPSIS
These are some answers to the Week 90 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a few days (December 13, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
Task 1: DNA Sequence
DNA is a long, chainlike molecule which has two strands twisted into a double helix. The two strands are made up of simpler molecules called nucleotides. Each nucleotide is composed of one of the four nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).
You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
Write a script to print nucleobase count in the given DNA sequence. Also print the complementary sequence where Thymine (T) on one strand is always facing an adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and vice versa.
To get the complementary sequence use the following mapping:
Welcome to the fifth post about the Kephra Base Object System, where I explain the need for three kinds of attributes: data, delegating and wrapping and gas a little about their properties. It is especially advised to have read the first part (scopes) and the previous part, since accessors are methods.
In case you wonder how practical this exercise is - I already implemented a slightly simpler version and currently rewrite it. It's a standalone bundle of modules with its own tests and docs named Base-Class (Kephra::Base::Class) (123kB), which depends only on the bundle Base (there are the data types) (32 kB). So once ready it could be released on CPAN without much work.
Many of you will know my good friend Peter Scott as a Perl luminary. More recently he has turned his attention and his considerable talents to focus on the future of AI, both as an unprecedented opportunity for our society...and as an unprecedented threat to our species.
A few years back, he released an excellent book on the subject, and just recently he was invited to speak on the subject at TEDx. His talk brilliantly sums up both the extraordinary possibilities and the terrible risks inherent in turning over our decision-making to systems whose capacities are increasingly growing beyond our own abilities, and perhaps soon beyond even our own understanding.
Whether our accelerating use of AI brings us utopia or extinction, the very real possibility of either outcome surely makes these twelve minutes well worth paying attention to.
On behalf of the Dancer Core Team, I’d like to announce the availability of Dancer2 0.300001. This maintenance release brings brings a revamped tutorial, fixing of a YAML-related regression, repair of an encoding bug, and a slew of documentation fixes.
The full changelog is as follows:
These are some answers to the Week 89 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Task 1: GCD Sums
You are given a positive integer $N.
Write a script to sum GCD of all possible unique pairs between 1 and $N.
Example 1:
Input: 3
Output: 3
gcd(1,2) + gcd(1,3) + gcd(2,3)
Example 2:
Input: 4
Output: 7
gcd(1,2) + gcd(1,3) + gcd(1,4) + gcd(2,3) + gcd(2,4) + gcd(3,4)
GCD Sums in Raku
Kth Permutation Sequence
Write a script to accept two integers n (>=1) and k (>=1). It should print the k-th permutation of n integers.
For example, n=3 and k=4, the possible permutation sequences are listed below:
123
132
213
231
312
321
The script should print the 4th permutation sequence 231.
The straightforward way is to generate all the permutations in the correct order and then output the kth one. To generate them, we can use recursion: To get all the permutations of n elements, start with each element and extend it with all the permutations of the remaining elements.
This is a part of Perl Weekly Challenge(PWC) #054 and the followings are related to my solution. If you want to challenge yourself on Perl, go to https://perlweeklychallenge.org, code the latest challenges, submit codes on-time (by GitHub or email) if possible, before reading my blog post.
My laptop spent about 40.5 hours for calculating the list for the extra credit in task #2. While it was calculating, I found that my code hadn't been optimized. Anyway, even if I optimized it by 50%, the wait of 20 hours could still be a record for an impatient and blunt person like me.
2nd Apr, 2020
time | number_reached
1427 1
1745 309560
1809 325441
1831 339572
1852 353486
1951 386882
2205 453250
2253 475841
2308 482951
2358 502248
3rd Apr, 2020
time | number_reached
0419 600125
1405 772771
1534 794982
1538 796651
1543 798343
1555 800112 At this point, I realized that I should do more optimization.
1558 801872
1607 803625
1630 808808
1724 822777
1730 824482
1955 859075
These are some answers to the Week 88 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a couple of days (November 29, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
Task 1: Array of Products
You are given an array of positive integers @N.
Write a script to return an array @M where $M[i] is the product of all elements of @N except the index $N[i].
Example 1:
This blog post contains the "missing comments" from my contribution to the Perl Weekly Challenge 055. If you haven't read the Task #2 Problem Description: Wave Array you might want to do that first.
My submission for PWC 056 Task #2.
The Idea
Sort your array of numbers. Select a number. You have now two sub-arrays:
- The sub-array "to the left" of the selected number, and
- The sub-array "to the right" of the selected number.
This sounds trivial, but I want to point out that the setup has been done so that "less than or equal to" or "greater than or equal to" are not mentioned. These qualities are implicit with the sort of the data when we start.
The algorithm then follows this idea:
- I have a sorted list of numbers listed vertically on a sheet of paper.
- I ask you to select any number in that list.
- I take that number, write it down,
- I draw a line through that number on the list.
REPEAT
Part 1.
On Match 20th I had keyhole surgery to repair the aortic arch.
The lining had peeled off the wall. This happens when the lining develops a tear due to (in my case) childhood and later stress. Then, blood is pumped thru the tear and thus between the lining and the wall. Where the blood ought to go is called the 'true lumen' and when it's behind the lining and thus where is should not be - which is the bad news - , is called the 'false lumen'. So it's blood pressure in the false lumen which splits the lining off the wall. I just checked that original post and now realise I did not explain that at all.
