Monthly Report - April

You are given an array @N of positive integers (sorted) and another non negative integer $k. Write a script to find if there exists 2 indices $i and $j such that$A[$i] - $A[$j] == $k and $i != $j. It should print the pairs of indices, if any such pairs exist.Example:
@N = (2, 7, 9); $k = 2;Output: 2, 1
I totally ignored the fact that the input array is sorted. My solution works for any input array, but it’s still rather efficient.
The basic trick is that we don’t have to compute $A[$i] - $A[$j] for each combination or $i and $j. We know $k from the very beginning, so we can just iterate the array for the first time to store it in a hash, and iterate it for the second time to check the hash whether the corresponding number exists in the array.
This blog post contains the "missing comments" from my contribution to the Perl Weekly Challenge 055. If you haven't read the Task #2 Problem Description: Wave Array you might want to do that first.
My submission for PWC 056 Task #2.
These are some answers to the Week 90 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a few days (December 13, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
DNA is a long, chainlike molecule which has two strands twisted into a double helix. The two strands are made up of simpler molecules called nucleotides. Each nucleotide is composed of one of the four nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).
You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
Write a script to print nucleobase count in the given DNA sequence. Also print the complementary sequence where Thymine (T) on one strand is always facing an adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and vice versa.
To get the complementary sequence use the following mapping:
Many of you will know my good friend Peter Scott as a Perl luminary. More recently he has turned his attention and his considerable talents to focus on the future of AI, both as an unprecedented opportunity for our society...and as an unprecedented threat to our species.
A few years back, he released an excellent book on the subject, and just recently he was invited to speak on the subject at TEDx. His talk brilliantly sums up both the extraordinary possibilities and the terrible risks inherent in turning over our decision-making to systems whose capacities are increasingly growing beyond our own abilities, and perhaps soon beyond even our own understanding.
Whether our accelerating use of AI brings us utopia or extinction, the very real possibility of either outcome surely makes these twelve minutes well worth paying attention to.
This blog post contains the "missing comments" from my contribution to the Perl Weekly Challenge 055. If you haven't read the Task #1 Problem Description: Flip Binary you might want to do that first.
Now to document a bit more, my submission for PWC 056 Task #1.
First, please feel free to suggest a better style of exposition. At work, I usually lard my code with comments galore, but with small demonstration programs I prefer to get as much code onto one page as possible, so now I'll try to illuminate a bit more my thoughts, no promises that they will be illuminating. Of course, let me know of any outright errors you catch as well, please.
These are some answers to the Week 89 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
You are given a positive integer $N.
Write a script to sum GCD of all possible unique pairs between 1 and $N.
Example 1:
Input: 3
Output: 3
gcd(1,2) + gcd(1,3) + gcd(2,3)
Example 2:
Input: 4
Output: 7
gcd(1,2) + gcd(1,3) + gcd(1,4) + gcd(2,3) + gcd(2,4) + gcd(3,4)
On behalf of the Dancer Core Team, I’d like to announce the availability of Dancer2 0.300001. This maintenance release brings brings a revamped tutorial, fixing of a YAML-related regression, repair of an encoding bug, and a slew of documentation fixes.
The full changelog is as follows:
Write a script to accept two integers n (>=1) and k (>=1). It should print the k-th permutation of n integers.For example, n=3 and k=4, the possible permutation sequences are listed below:
123 132 213 231 312 321The script should print the 4th permutation sequence 231.
The straightforward way is to generate all the permutations in the correct order and then output the kth one. To generate them, we can use recursion: To get all the permutations of n elements, start with each element and extend it with all the permutations of the remaining elements.
This is a part of Perl Weekly Challenge(PWC) #054 and the followings are related to my solution. If you want to challenge yourself on Perl, go to https://perlweeklychallenge.org, code the latest challenges, submit codes on-time (by GitHub or email) if possible, before reading my blog post.
My laptop spent about 40.5 hours for calculating the list for the extra credit in task #2. While it was calculating, I found that my code hadn't been optimized. Anyway, even if I optimized it by 50%, the wait of 20 hours could still be a record for an impatient and blunt person like me.
2nd Apr, 2020
time | number_reached
1427 1
1745 309560
1809 325441
1831 339572
1852 353486
1951 386882
2205 453250
2253 475841
2308 482951
2358 502248
3rd Apr, 2020
time | number_reached
0419 600125
1405 772771
1534 794982
1538 796651
1543 798343
1555 800112 At this point, I realized that I should do more optimization.
1558 801872
1607 803625
1630 808808
1724 822777
1730 824482
1955 859075
These are some answers to the Week 88 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a couple of days (November 29, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
You are given an array of positive integers @N.
Write a script to return an array @M where $M[i] is the product of all elements of @N except the index $N[i].
Example 1:
On Match 20th I had keyhole surgery to repair the aortic arch.
The lining had peeled off the wall. This happens when the lining develops a tear due to (in my case) childhood and later stress. Then, blood is pumped thru the tear and thus between the lining and the wall. Where the blood ought to go is called the 'true lumen' and when it's behind the lining and thus where is should not be - which is the bad news - , is called the 'false lumen'. So it's blood pressure in the false lumen which splits the lining off the wall. I just checked that original post and now realise I did not explain that at all.
Write a script to rotate the following matrix by given 90/180/270 degrees clockwise.[ 1, 2, 3 ] [ 4, 5, 6 ] [ 7, 8, 9 ]For example, if you rotate by 90 degrees then expected result should be like below
[ 7, 4, 1 ] [ 8, 5, 2 ] [ 9, 6, 3 ]
The easiest way to work with multidimensional data in Perl is PDL. Interestingly, I haven’t found a direct method to rotate a matrix in this way.
What I have found, though, was a method to transpose a matrix, which means to switch the columns and rows. The result for the sample input is
These are some answers to the Week 87 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a few days (November 22, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
You are given an unsorted array of integers @N.
Write a script to find the longest consecutive sequence. Print 0 if none sequence found.
Example 1:
Input: @N = (100, 4, 50, 3, 2)
Output: (2, 3, 4)
Example 2:
Input: @N = (20, 30, 10, 40, 50)
Output: 0
Example 3:
Input: @N = (20, 19, 9, 11, 10)
Output: (9, 10, 11)
#the spiral for the simpler script
3, 2, 1,
4, X, 0,
5, 6, 7
It has been a little while since I played with my little PAWS and yes like many of us these days I have been just a little distracted, trip planned, trip changed, trip canceled etc etc etc.
Anyway to recap where I left off I was just getting the 'SubscribeToShard' action to work with a HTTP stream to work, after a fashion anyway. Then I got side tracked a little playing about with the problem of testing if the stream was correctly sending data down the pipe and if I was decoding it correctly.
As a byproduct of getting to the bottom of that I finally figured out what the PAWS 'Paginators' are for and I guess how to use them.
I noticed the odd "NextToken" tag in some of the Boto Json files as well most of the services have a ''paginators-1.json' definition file as well and looking at the Kinesis pod I see that there paginators listed.
PAGINATORS
Paginator methods are helpers that repetitively call methods that return partial results
…
These are some answers to the Week 86 of the Perl Weekly Challenge organized by Mohammad S. Anwar.
Spoiler Alert: This weekly challenge deadline is due in a day or so (November 15, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.
You are given an array of integers @N and an integer $A.
Write a script to find find if there exists a pair of elements in the array whose difference is $A.
Print 1 if exists otherwise 0.
Example 1:
Input: @N = (10, 8, 12, 15, 5) and $A = 7
Output: 1 as 15 - 8 = 7
Example 2:
Input: @N = (1, 5, 2, 9, 7) and $A = 6
Output: 1 as 7 - 1 = 6
Example 3:
blogs.perl.org is a common blogging platform for the Perl community. Written in Perl with a graphic design donated by Six Apart, Ltd.