blogs.perl.org

I have been doing Monthly Report since June 2018 non-stop. It has become a ritual for me now. It gives me an opportunity to look upon my activities. Since the beginning of the year 2020, I have made conscious decision to slow down as far as submitting Pull Request. I have also stopped playing CPAN game of daily upload after breaking the chain three times. I am happy that Perlancar is keeping the game alive. It has given me space to try something new. Although COVID-19 keeping us indoor all the time, still looking for interesting project to keep the mind busy.

These are some answers to the Week 94 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few of days (January 10, 2021). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Group Anagrams

You are given an array of strings @S.

Write a script to group Anagrams together in any random order.

An Anagram is a word or phrase formed by rearranging the letters of a different word or phrase, typically using all the original letters exactly once.

Example 1:

Input: ("opt", "bat", "saw", "tab", "pot", "top", "was")
Output: [ ("bat", "tab"),
          ("saw", "was"),
          ("top", "pot", "opt") ]

Example 2:

Input: ("x")
Output: [ ("x") ]

This is a part of Perl Weekly Challenge(PWC) #060 and the followings are related to my solution. If you want to challenge yourself on Perl, go to https://perlweeklychallenge.org, code the latest challenges, submit codes on-time (by GitHub or email) if possible, before reading my blog post

Do tell me if I am wrong or you strongly oppose my statements!

Task #1: Excel Column

Firstly we observe that 16384 < 26³ = 17576 . Therefore there are at most 3 alphabets for the spreedsheet nomenclature. Knowing the cases to handle are not massive, I handle the cases with some subroutines named AtoOne, AtoZero and OnetoA.

Task #2 Find Numbers

The original task makes me feel it is an exercise for using the module Math::Combinatorics .

Afterall, hence I modify the following more mathematically interesting task for myself:

Paging PAWS for fun an profit

Egad have been away for a while, it is not due to laziness on my part, I really have been stuck on a Paws problem over the past month+, add to that dozens of inside and out sided projects that I need to get done around the house time has just not been there.

At least I have finally cracked it.

I really went down a rabbit hole for this one and spend way too many hours trying to figure out how to test 'Paws Pagination' end to end.

In my last post I started out with a new test suite '30_pagination.t' and a few test YAMLs.

Just getting the YAML just right took God only knows how many iterations. I also had to create a completely new caller 'TestPaginationCaller.pm' to get the tests to work.

https://perlweeklychallenge.org/blog/weekly-challenge-062

These are some answers to the Week 93 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a day or so. This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Max Points

You are given set of co-ordinates @N.

Write a script to count maximum points on a straight line when given co-ordinates plotted on 2-d plane.

Example 1:

Excel Column

Write a script that accepts a number and returns the Excel Column Name it represents and vice-versa.

Excel columns start at A and increase lexicographically using the 26 letters of the English alphabet, A..Z. After Z, the columns pick up an extra “digit”, going from AA, AB, etc., which could (in theory) continue to an arbitrary number of digits. In practice, Excel sheets are limited to 16,384 columns.

Example

Input Number: 28
Output: AB

Input Column Name: AD
Output: 30

This seemed like a simple base 10 to base 26 conversion and back. I started by installing Math::Base::Convert, Math::BaseConvert, Math::BaseCnv, and Convert::AnyBase to quickly discover they wouldn’t help me much. What Excel uses for column names is a weird 26 digit system that lacks a symbol for zero, but has a symbol for 26 (or for 10₂₆). It’s called the bijective base-26 numeration system. The interesting fact about such systems is that digit addition, subtraction, and multiplication work the same way as in our common system (division is a bit problematic).

PWC Task #1, Linked List

jaredor submission for Task #1

Partitioning an input array into a @lower and @upper array based on a pivot element, $k, and then recombining into an output array (@lower, @upper) is pretty easy, e.g.,

say join(' ', (grep { $_ < $k } @ARGV), (grep { $k <= $_ } @ARGV));

A linked list can be collapsed into an array easily enough, so the challenge here (for me) is to add a little extra in the handling that could be useful in the future (because I always steal from myself ;-)

So maybe the little extra is this: Once a link is made it won't be copied.

I started explaining everything and it started feeling like I was writing a very boring novel. Below I'll just stick to the link logic.

Details

Input

There is one command line option:

--k

Specify the pivot point, k, per the problem instructions. [REQUIRED]

The arguments are the elements of the chain, in order, from HEAD to TAIL, since I like to make things as easy for myself as possible.

Link Logic

This is a part of Perl Weekly Challenge(PWC) #059 and the followings are related to my solution. If you want to challenge yourself on Perl, go to https://perlweeklychallenge.org, code the latest challenges, submit codes on-time (by GitHub or email) if possible, before reading my blog post.

(Finally, I installed a Linux distribution in my laptop -- my choice is Linux Mint (a distribution forked from earlier Ubuntu) .) (In Hong Kong, there are no shops selling Linux-installed/Linux-Windows-dual-boot laptop. People^[1] are too rich and just buy Windows pre-installed laptops or MacBooks.(???) ) (This is not my first time to own a laptop with Linux but this time I am more serious about the system setting.)

The COVID-19 virus pandemic is under control in Hong Kong these two week. What a piece of good news.

Perl Weekly Challenge #058

These are some answers to the Week 92 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few hours. This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Isomorphic Strings

You are given two strings $A and $B.

Write a script to check if the given strings are Isomorphic. Print 1 if they are, otherwise 0.

Example 1:

Input: $A = "abc"; $B = "xyz"
Output: 1

Example 2:

Input: $A = "abb"; $B = "xyy"
Output: 1

Example 3:

Input: $A = "sum"; $B = "add"
Output: 0

Isomorphic Strings in Raku

Linked List

You are given a linked list and a value k. Write a script to partition the linked list such that all nodes less than k come before nodes greater than or equal to k. Make sure you preserve the original relative order of the nodes in each of the two partitions.

For example:

Linked List: 1 → 4 → 3 → 2 → 5 → 2
k = 3
Expected Output: 1 → 2 → 2 → 4 → 3 → 5.

We saw Linked List not so long ago, when solving the LRU Cache. Nevertheless, I didn’t reuse my solution, as I previously used a cyclic variant which doesn’t seem to be helpful here.

So, let’s start with a class of list elements. I call them “nodes”. Each node has a value and a link to a next node (undef if there’s none). A node can be disconnected from the next node, or a new node can be attached to it.

https://perlweeklychallenge.org/blog/weekly-challenge-058

The last time I spoke at Craft Conference, I also took part in what is probably the most fun and unusual interview of my career: Ivette Ördög’s Morning Commute.

Bear in mind, however, that this discussion took place back in 2018, so you’ll need to mentally s/Perl 6/Raku/ in a couple of places.

Even if you’re not interested in my random thoughts on the importance of linguistic diversity, Ivette’s other interviews are well worth watching.

These are some answers to the Week 91 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few days (December 20, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: Count Numbers

You are given a positive number $N.

Write a script to count number and display as you read it.

Example 1:

Input: $N = 1122234
Output: 21321314

as we read "two 1 three 2 one 3 one 4"

Example 2:

PWC Task #1, Compare Version

jaredor submission for Task #1

I usually am bored with string twisting (as opposed to bit twiddling) because there is a certain level of grunt work, even with such classics as ELIZA and FESTOON and I can easily fall down the rabbit hole of trying to get pluralization perfect. So when the exciting topic of version numbers came up, I would have passed, but we perfectionists have to finish one to get to two....

Plus there was one thing that I liked, the problem was set up as a comparison operator, like <=> and cmp, suitable for use in a sort routine. Whomever you are out there, with a need to sort thousands of version strings via perl, this script is for you ;-)

Input

Input is on the command line. The versions will be compared in pairs. Creating a version sort routine of command line arguments was considered, but I decided to emulate the problem statement example output instead.

Details

A very welcome PR for adding the new SLA parameters for RT 4.4.3 was provided to RT::Client::REST on githib, which went out in v0.57 just earlier this week.

However this spurred me to take care of another PR that was been floating which allowed more verbose error messaging to be enabled. I also returned to my proposed fix for RT118729 which is because of mishandling of RT's strange "REST" (it's not really) interface.

If you are using RT::Client::REST i urge you to update it. Testing it carefully first before deploying. Bug reports are welcome especially when a fix is provided!

See https://metacpan.org/release/RT-Client-REST

These are some answers to the Week 90 of the Perl Weekly Challenge organized by Mohammad S. Anwar.

Spoiler Alert: This weekly challenge deadline is due in a few days (December 13, 2020). This blog post offers some solutions to this challenge, please don’t read on if you intend to complete the challenge on your own.

Task 1: DNA Sequence

DNA is a long, chainlike molecule which has two strands twisted into a double helix. The two strands are made up of simpler molecules called nucleotides. Each nucleotide is composed of one of the four nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).

You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.

Write a script to print nucleobase count in the given DNA sequence. Also print the complementary sequence where Thymine (T) on one strand is always facing an adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and vice versa.

To get the complementary sequence use the following mapping:

This is a part of Perl Weekly Challenge(PWC) #057 and the followings are related to my solution.

Do tell me if I am wrong or you strongly oppose my statements!

Task 1: Invert Tree

There is a module Tree::Binary on CPAN and its method "mirror" does what exactly describe in the Task 1. Of course, the experience of using a shortcut won't be filled a blog post.

Last week (PWC #056) I did not attempt the binary tree task but I did read the blogs of other PWC members.

Hence, it's time for my "blog report". Blog posts I use as reference are

• https://ry.ca/2020/04/path-sum/
• https://raku-musings.com/diff-sum.html
• https://blogs.perl.org/users/laurent_r/2020/04/perl-weekly-challenge-56-diff-k-and-path-sum.html

Discovered from reading, one of the ways of representing a binary tree which I hadn't thought of but very intuitive, is putting the nodes row by row!

Just like this:

https://perlweeklychallenge.org/blog/weekly-challenge-060